Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.089239 |
Chromosome: | chromosome 16 |
Location: | 3730010 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g689001 | (1 of 100) IPR001810 - F-box domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAACAGCAAACACAAAAAGGCGCTTTTTA |
Internal bar code: | CTCGGGTACGCGGACTAAAGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 13 |
LEAP-Seq percent confirming: | 87.0879 |
LEAP-Seq n confirming: | 317 |
LEAP-Seq n nonconfirming: | 47 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTCCTCCACAGTCCTCTGC |
Suggested primer 2: | AGCAGGTATGGTACGGTTGC |