| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.089260 |
| Chromosome: | chromosome 10 |
| Location: | 52357 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g417850 | (1 of 1) IPR003613//IPR011047 - U box domain // Quinonprotein alcohol dehydrogenase-like superfamily | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCGCCACTGCCGGGCCTGGCAGTAAGC |
| Internal bar code: | GATTTCCGTGGACGTCGCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 151 |
| LEAP-Seq percent confirming: | 45.0237 |
| LEAP-Seq n confirming: | 950 |
| LEAP-Seq n nonconfirming: | 1160 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTGGGACTGGGACTTTGA |
| Suggested primer 2: | AAGGCTCTGAGCTACCTCCC |