| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.089340 |
| Chromosome: | chromosome 6 |
| Location: | 1597584 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g260600 | PPP22 | Phosphoprotein phosphatase 2A regulatory subunit related; (1 of 2) K11583 - serine/threonine-protein phosphatase 2A regulatory subunit B'' (PPP2R3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGTGGGTGTGCAGGTAGGTAGGTAGAGT |
| Internal bar code: | TGGGGATGAGACGGCTCGTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 644 |
| LEAP-Seq percent confirming: | 99.7715 |
| LEAP-Seq n confirming: | 6987 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGCAGAAACACAGCAGGA |
| Suggested primer 2: | TCAGTGCCAGTCTCGTTGAC |