Insertion junction: LMJ.RY0402.089356_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.089356
Chromosome:chromosome_10
Location:1651672
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GAGCAGCGGCGGCCCCGGCGGTAACGGCTC
Internal bar code:GGCATTATCTGGATTTTGACTC

Confirmation - LEAP-Seq

LEAP-Seq distance:168
LEAP-Seq percent confirming:90.1919
LEAP-Seq n confirming:423
LEAP-Seq n nonconfirming:46
LEAP-Seq n unique pos:12

Suggested primers for confirmation by PCR

Suggested primer 1:GTGCTACCACCTGTCTGCAA
Suggested primer 2:AAGGAGAAGGGGAACAAGGA