| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.089406 |
| Chromosome: | chromosome 14 |
| Location: | 1997168 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g621450 | RPL5 | Ribosomal protein L5, component of cytosolic 80S ribosome and 60 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCGCAGCCTCCAAAGCCGCAGCTGTTGC |
| Internal bar code: | CAGAACGCAGGGTCCTATGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 368 |
| LEAP-Seq percent confirming: | 91.5612 |
| LEAP-Seq n confirming: | 434 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATCCCATCAGAACTCGGAA |
| Suggested primer 2: | CGCACGTTCAAGCTCAGTAG |