| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.089442 |
| Chromosome: | chromosome 5 |
| Location: | 1171654 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g245550 | PIK1 | (1 of 1) PTHR10048//PTHR10048:SF15 - PHOSPHATIDYLINOSITOL KINASE // PHOSPHATIDYLINOSITOL 4-KINASE ALPHA-LIKE PROTEIN P2-RELATED; Phosphatidylinositol 4-kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGCTTCTCACCACCTGCTTCTCCCCCT |
| Internal bar code: | ATCTGCGCACCGCGAATGTGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 185 |
| LEAP-Seq percent confirming: | 72.973 |
| LEAP-Seq n confirming: | 54 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCCCCTAGGTATCCTGA |
| Suggested primer 2: | TAGGGGCACAGGTACAGGTC |