| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.089451 |
| Chromosome: | chromosome 3 |
| Location: | 3776723 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g170100 | (1 of 1) PTHR31840//PTHR31840:SF1 - FAMILY NOT NAMED // COILED-COIL DOMAIN-CONTAINING PROTEIN 97 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCCGCCGCTGCTCCAGTTGCGCCTCGT |
| Internal bar code: | CACGGACTCGCGGCGCAGTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6 |
| LEAP-Seq percent confirming: | 50.1575 |
| LEAP-Seq n confirming: | 796 |
| LEAP-Seq n nonconfirming: | 791 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTGAAGCGGAAATACGTGG |
| Suggested primer 2: | GCGTGTTCATCCCTGGTACT |