| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.089474 |
| Chromosome: | chromosome 16 |
| Location: | 7285482 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g683483 | REX1-B,REX1B | (1 of 1) PF14966 - DNA repair REX1-B (DNA_repr_REX1B); DNA repair protein and protein of unknown function | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCTAGGCCAGACCTATTGAGCCCATCC |
| Internal bar code: | CGATGCGCTCCACAGTCGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 354 |
| LEAP-Seq percent confirming: | 99.6337 |
| LEAP-Seq n confirming: | 1360 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATAGCTTTCTGTGAGGGC |
| Suggested primer 2: | GACGACAGACAAGTGGCAGA |