Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.089529 |
Chromosome: | chromosome 6 |
Location: | 3455838 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278094 | ELG14 | Exostosin-like glycosyltransferase 14; (1 of 34) 2.4.2.41 - Xylogalacturonan beta-1,3-xylosyltransferase / Xylogalacturonan xylosyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGCACGTGTCGTTGATGCCCGGCGGGT |
Internal bar code: | TATTGTTTTCGGCTCGTTTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 194 |
LEAP-Seq percent confirming: | 95.647 |
LEAP-Seq n confirming: | 2395 |
LEAP-Seq n nonconfirming: | 109 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAGTCAGAGGCTCAGGAGG |
Suggested primer 2: | ACCGCCATCTACAACACCTC |