| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.089546 |
| Chromosome: | chromosome 16 |
| Location: | 1790137 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g655200 | PTB6 | Sodium/phosphate symporter PTB6b; (1 of 9) K14640 - solute carrier family 20 (sodium-dependent phosphate transporter) (SLC20A, PIT) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTCGGGCGAGAACACCTCAGCAGCAGCG |
| Internal bar code: | GAAGAGTCTGTTAAGCGATAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 634 |
| LEAP-Seq percent confirming: | 99.6162 |
| LEAP-Seq n confirming: | 4932 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCCCCGTTACTGACACAT |
| Suggested primer 2: | ATGTTGTAGCCGTAGGTGGC |