| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.089577 |
| Chromosome: | chromosome 6 |
| Location: | 6985869 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g296550 | FMO3 | Flavin-containing monooxygenase; (1 of 3) K00485 - dimethylaniline monooxygenase (N-oxide forming) (FMO) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCGGCGTCGGTTCGAGCGGGCCAGTCG |
| Internal bar code: | CCCAAACGCTGTGTCTTCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1018 |
| LEAP-Seq percent confirming: | 99.7601 |
| LEAP-Seq n confirming: | 15805 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGAAGGCTGGAACACACAG |
| Suggested primer 2: | TGGAGGTGTGATGAGCAGAG |