| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.089579 |
| Chromosome: | chromosome 2 |
| Location: | 7611910 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g143550 | ELIP3,ELI4,ELI3,LCI16 | Early light-induced LHC-like protein; (1 of 6) PTHR14154:SF5 - EARLY LIGHT-INDUCED PROTEIN 1, CHLOROPLASTIC-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTAGGCAGGGTTACAGTTCAGAGCACCTG |
| Internal bar code: | CACACGCATTTTTCTTCGTATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 960 |
| LEAP-Seq percent confirming: | 99.5915 |
| LEAP-Seq n confirming: | 16334 |
| LEAP-Seq n nonconfirming: | 67 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCACAACCACCACTCCCT |
| Suggested primer 2: | CCCCTAAATCCTCGCACATA |