| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.089599 |
| Chromosome: | chromosome 14 |
| Location: | 366300 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g610351 | (1 of 1) PTHR28234//PTHR28234:SF1 - FAMILY NOT NAMED // NUCLEAR CONTROL OF ATPASE PROTEIN 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGGACACACACACACGCACGCACCTGTC |
| Internal bar code: | GCACGATCGGTCAATGAATCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 397 |
| LEAP-Seq percent confirming: | 79.6992 |
| LEAP-Seq n confirming: | 1166 |
| LEAP-Seq n nonconfirming: | 297 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGGGGGTAGGGGTTGGTA |
| Suggested primer 2: | TACCAGCCCAAATTAAACCG |