Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.089785 |
Chromosome: | chromosome 12 |
Location: | 4251340 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g519180 | EFT1a,PSRP7,EFT1 | Chloroplast elongation factor Ts-like protein; (1 of 1) K02357 - elongation factor Ts (tsf, TSFM) | 3'UTR|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCAGGGTACTCGGCGTGCTCTGCCGCCA |
Internal bar code: | CCGGCGCACGACGACTCTGCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 792 |
LEAP-Seq percent confirming: | 98.4203 |
LEAP-Seq n confirming: | 2679 |
LEAP-Seq n nonconfirming: | 43 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACCGCTTTTCTCTTTGACG |
Suggested primer 2: | TGACTGCTTGACCTTGCATC |