| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.089806 |
| Chromosome: | chromosome 12 |
| Location: | 4237560 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g519100 | ACC1,ACX2 | (1 of 1) K01962 - acetyl-CoA carboxylase carboxyl transferase subunit alpha (accA); Alpha-carboxyltransferase (ACCase complex) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACACCCTCTCTCCTGGCGTCACGCCACC |
| Internal bar code: | AGCCCTTTCATGGCACCGGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 736 |
| LEAP-Seq percent confirming: | 99.5781 |
| LEAP-Seq n confirming: | 472 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGGTGAGAGTGCCACAAG |
| Suggested primer 2: | CCGTTGCGTCGTCTGTAGTA |