Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.089920 |
Chromosome: | chromosome 7 |
Location: | 2669312 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g330750 | PHC43 | Putative pherophorin-chlamydomonas homolog; (1 of 1) IPR006311//IPR024616 - Twin-arginine translocation pathway, signal sequence // Pherophorin | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCACAGACAAGGCGTGCAAGGCGACGATC |
Internal bar code: | ACGGCGATTCATGTTAATCCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 372 |
LEAP-Seq percent confirming: | 99.6763 |
LEAP-Seq n confirming: | 7698 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGATGCTGTCGGTGTAGA |
Suggested primer 2: | CTCGACATGTGCTACGAGGA |