| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.089926 |
| Chromosome: | chromosome 9 |
| Location: | 5702441 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g401552 | (1 of 2) IPR000104//IPR002893//IPR003072 - Antifreeze protein, type I // Zinc finger, MYND-type // Orphan nuclear receptor, NOR1 type | 5'UTR|intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCAAGCCTATGCATGCAACATAGTATTG |
| Internal bar code: | GAGTCGAAGACGCGGTGCACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 676 |
| LEAP-Seq percent confirming: | 97.5995 |
| LEAP-Seq n confirming: | 3212 |
| LEAP-Seq n nonconfirming: | 79 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCTGCGACTTATGGAACA |
| Suggested primer 2: | ACACGGTAGGAGGACCAGTG |