Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.089957 |
Chromosome: | chromosome 12 |
Location: | 4722754 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g523650 | HLM19 | (1 of 68) 2.1.1.43 - Histone-lysine N-methyltransferase / Protein-lysine N-methyltransferase; Histone-lysine N-methyltransferase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGTGCAGGAGGGGCAAGAGTGTGCTGGC |
Internal bar code: | AGCTGCCCTAATTGGTTGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 72 |
LEAP-Seq percent confirming: | 66.9725 |
LEAP-Seq n confirming: | 73 |
LEAP-Seq n nonconfirming: | 36 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACGTGTCCGGAATTAGCAC |
Suggested primer 2: | ACCCACTGTAACCATGCACA |