| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.090023 |
| Chromosome: | chromosome 2 |
| Location: | 404257 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g076000 | LAT3,STK1,STPK1,SNRK2K | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase; snRK1 family in Chlamydomonas, subgroup 2; Latrunculin-B sensitive 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTCGGCCAGAGCGAATCGGTACAAGCTT |
| Internal bar code: | CGTTTAGTTTCACGGTATCCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 201 |
| LEAP-Seq percent confirming: | 99.7709 |
| LEAP-Seq n confirming: | 871 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCACTGACAAGCCCTGAT |
| Suggested primer 2: | GCAAGGAAAGACCTGCTCAC |