Insertion junction: LMJ.RY0402.090027_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.090027
Chromosome:chromosome_13
Location:1619020
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre13.g573500 FAP95 Flagellar Associated Protein sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):ACGGCATCCAGGGGCACGGAATTGCCTAGT
Internal bar code:TCCGGGGCTTCATGCGTGCCCA

Confirmation - LEAP-Seq

LEAP-Seq distance:698
LEAP-Seq percent confirming:99.5854
LEAP-Seq n confirming:5044
LEAP-Seq n nonconfirming:21
LEAP-Seq n unique pos:8

Suggested primers for confirmation by PCR

Suggested primer 1:TGCAGATGAGGGTGAGAGTG
Suggested primer 2:TGTCTATGCTTGGCGTTGAG