Insertion junction: LMJ.RY0402.090027_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.090027
Chromosome:chromosome_13
Location:1619034
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre13.g573500 FAP95 Flagellar Associated Protein sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TTACTGCCCTTCTCGCCAGCGGCGGCGGCC
Internal bar code:CCACCCGCGGTCGACAGTTGTG

Confirmation - LEAP-Seq

LEAP-Seq distance:612
LEAP-Seq percent confirming:94.729
LEAP-Seq n confirming:3828
LEAP-Seq n nonconfirming:213
LEAP-Seq n unique pos:57

Suggested primers for confirmation by PCR

Suggested primer 1:TGCAGATGAGGGTGAGAGTG
Suggested primer 2:TGTCTATGCTTGGCGTTGAG