Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.090066 |
Chromosome: | chromosome 1 |
Location: | 7373189 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g052950 | PSO2 | (1 of 2) PTHR23240:SF6 - DNA CROSS-LINK REPAIR 1A PROTEIN; DNA damage checkpoint protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGTACTCGAAAGGGCCCAGCCCCCTCAC |
Internal bar code: | ATCGGCAAAACGCGCGTATCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 694 |
LEAP-Seq percent confirming: | 98.6199 |
LEAP-Seq n confirming: | 5288 |
LEAP-Seq n nonconfirming: | 74 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGGCTCTGACTGTAGGAAG |
Suggested primer 2: | ATGGGTGCTGGTGATCTAGG |