| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.090206 |
| Chromosome: | chromosome 9 |
| Location: | 3369564 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g388726 | (1 of 1) 3.1.3.32 - Polynucleotide 3'-phosphatase / 2'(3')-polynucleotidase | 3'UTR|intron|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTCACGTGCCATTTCGCTGGACAATCGC |
| Internal bar code: | GGTCATCAGCCACATAGAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 405 |
| LEAP-Seq percent confirming: | 99.6694 |
| LEAP-Seq n confirming: | 603 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAAACTGCTGCCAAGAAGG |
| Suggested primer 2: | TCAGTGTCACGCAGGATAGC |