Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.090250 |
Chromosome: | chromosome 1 |
Location: | 2711358 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g016100 | (1 of 7) IPR011048 - Cytochrome cd1-nitrite reductase-like, haem d1 domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTTATTTTGCTCGCGCTTGCACTGCTGC |
Internal bar code: | TCGGCGACAGTCGGCGTATGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 523 |
LEAP-Seq percent confirming: | 97.958 |
LEAP-Seq n confirming: | 4893 |
LEAP-Seq n nonconfirming: | 102 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGCTAGTGGCCTGGTTCTT |
Suggested primer 2: | CGCAAGTCTTTGACCTCTCC |