Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.090300 |
Chromosome: | chromosome 3 |
Location: | 5259504 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g183250 | (1 of 1) IPR027437 - 30s ribosomal protein S13, C-terminal | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGCGGGCAGCTTCAAGCTCTTGTTTAGC |
Internal bar code: | TGCCCCCGTAGGAGGTATAACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 398 |
LEAP-Seq percent confirming: | 99.6345 |
LEAP-Seq n confirming: | 1908 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCGTTTAGCAAAGGTTGAA |
Suggested primer 2: | AAAGCAAAACTTGCGGAGAA |