Insertion junction: LMJ.RY0402.090346_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.090346
Chromosome:chromosome_11
Location:331190
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre11.g467567 UBQ1 Ubiquitin antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):ATCTTGACAAGCGCCGCGAGGGCCGGTTGC
Internal bar code:CCCCCGCCGTGGTGCCCAAGTC

Confirmation - LEAP-Seq

LEAP-Seq distance:649
LEAP-Seq percent confirming:94.3396
LEAP-Seq n confirming:1050
LEAP-Seq n nonconfirming:63
LEAP-Seq n unique pos:14

Suggested primers for confirmation by PCR

Suggested primer 1:CCATTAAGGCGGTGAGAAAA
Suggested primer 2:CTCGGATTCCGTGATCTTGT