Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.090492 |
Chromosome: | chromosome 4 |
Location: | 2002137 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g218800 | THB3 | (1 of 1) IPR001486//IPR008207//IPR009050 - Truncated hemoglobin // Signal transduction histidine kinase, phosphotransfer (Hpt) domain // Globin-like; Truncated hemoglobin | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAATGGAAACCGTCCACCGCACTGACCCAA |
Internal bar code: | GCCACGGACTGGATCGGCTGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 624 |
LEAP-Seq percent confirming: | 99.1386 |
LEAP-Seq n confirming: | 2417 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCATGCCCAATGATATAG |
Suggested primer 2: | ACTTGCATCTGGGTTTGTCC |