Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.090515 |
Chromosome: | chromosome 12 |
Location: | 5917938 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g534151 | EEP9 | (1 of 3) PTHR22748:SF4 - DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE 2; endonuclease/exonuclease/phosphatase family protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGATCTGAGGCCACCCCCTCCCTCCCTTC |
Internal bar code: | GAGAGATCGTGCTTAACCGAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 250 |
LEAP-Seq percent confirming: | 80.8989 |
LEAP-Seq n confirming: | 144 |
LEAP-Seq n nonconfirming: | 34 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCTTGAGGTCCTCCATGTC |
Suggested primer 2: | GCCTCTCCAAAGAGCATTTC |