Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.090600 |
Chromosome: | chromosome 3 |
Location: | 5384644 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g184600 | RWP7 | (1 of 1) IPR003035//IPR009057 - RWP-RK domain // Homeodomain-like; RWP-RK transcription factor | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGGCGCTTGATGTCCTCCTCCACCTCCA |
Internal bar code: | ATCTTGTCCTGACCTTACTACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 661 |
LEAP-Seq percent confirming: | 99.5134 |
LEAP-Seq n confirming: | 818 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTGTCGTGCTATGCAGTGG |
Suggested primer 2: | CTATCCTACCGCTCGACTGC |