Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.090604 |
Chromosome: | chromosome 13 |
Location: | 2976331 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g584100 | (1 of 66) 2.7.12.1 - Dual-specificity kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGAGAAGATAAACAGGCCACGGGCATGT |
Internal bar code: | GACTAGCGCGACATCAGGTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 679 |
LEAP-Seq percent confirming: | 98.2225 |
LEAP-Seq n confirming: | 2763 |
LEAP-Seq n nonconfirming: | 50 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGAGCTTGAAACAGTCGGG |
Suggested primer 2: | CGGGTGACCAACAGTTTTCT |