| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.090628 |
| Chromosome: | chromosome 9 |
| Location: | 6433048 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g407100 | MRPS5,uS5m | Mitochondrial ribosomal protein S5; (1 of 1) PTHR13718:SF61 - 28S RIBOSOMAL PROTEIN S5, MITOCHONDRIAL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCCCCTCACCCGCATGTTGCCGGTGGC |
| Internal bar code: | AAGACGCGCGAGTAAGGTCAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 141 |
| LEAP-Seq percent confirming: | 25.658 |
| LEAP-Seq n confirming: | 3285 |
| LEAP-Seq n nonconfirming: | 9518 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGGTCTAGCTTGGGTTGG |
| Suggested primer 2: | AAAGAGGGAAAGAGGAAGCG |