| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.090718 |
| Chromosome: | chromosome 12 |
| Location: | 5647582 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g532350 | CAV8 | (1 of 2) PF00520//PF08016 - Ion transport protein (Ion_trans) // Polycystin cation channel (PKD_channel); Voltage-gated Ca2+ channel, alpha subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGGTGGTATCACACCCACGTGCATGCA |
| Internal bar code: | TTCGTGTCAGTCTTGGGGCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1307 |
| LEAP-Seq percent confirming: | 99.7639 |
| LEAP-Seq n confirming: | 9718 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCGTACATTGTGCCGAAA |
| Suggested primer 2: | GAGATTTGTCCGGGAGATGA |