Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.090729 |
Chromosome: | chromosome 4 |
Location: | 1435437 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g214250 | AGO2 | Argonaute-like protein; (1 of 3) PTHR22891:SF0 - PROTEIN ARGONAUTE-2 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCGCCCTGCTGCTCCACAGCGCTCTCTC |
Internal bar code: | TATCCGGAGAGCCGTGGACATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 100 |
LEAP-Seq percent confirming: | 92.2619 |
LEAP-Seq n confirming: | 465 |
LEAP-Seq n nonconfirming: | 39 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCGGAAGAGATTTGGAGGT |
Suggested primer 2: | TGCCCAAACACCAGACACTA |