| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.090786 |
| Chromosome: | chromosome 2 |
| Location: | 7384064 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g144800 | LCI8 | bifunctional N-acetylglutamate synthase/acetylglutamate kinase; (1 of 1) K14682 - amino-acid N-acetyltransferase (argAB) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCTCCTCTCCATCAACTACATCAAGCA |
| Internal bar code: | CCTTAGCGCGGCACACGGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 656 |
| LEAP-Seq percent confirming: | 97.7467 |
| LEAP-Seq n confirming: | 4815 |
| LEAP-Seq n nonconfirming: | 111 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCTCTGCTTATCGCCACT |
| Suggested primer 2: | GCACGTCTGTATGCCTCTGA |