| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.090798 |
| Chromosome: | chromosome 16 |
| Location: | 7351035 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g684715 | DCL2 | Dicer-like protein; (1 of 4) 3.1.26.3 - Ribonuclease III / RNase III | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAATCCTTTGGCTGCCAGCCGTATCACAT |
| Internal bar code: | GGAATGGAGTACGACACGGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 306 |
| LEAP-Seq percent confirming: | 82.3187 |
| LEAP-Seq n confirming: | 7640 |
| LEAP-Seq n nonconfirming: | 1641 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCAGTCCAAGGGACAAGG |
| Suggested primer 2: | CACACGCATGCACCTATACC |