| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.090802 |
| Chromosome: | chromosome 5 |
| Location: | 2271240 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234665 | AP4B4 | Beta4-Adaptin; (1 of 1) PTHR11134:SF4 - AP-4 COMPLEX SUBUNIT BETA-1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCACGCATAGCAGCCCCGTGGGAGCATGT |
| Internal bar code: | ATTAGCCCACGGCCGGGAAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1107 |
| LEAP-Seq percent confirming: | 99.6154 |
| LEAP-Seq n confirming: | 259 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCCAGAATCCAGAGCACC |
| Suggested primer 2: | TACTTCTACGGCCAGACGCT |