| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.090923 |
| Chromosome: | chromosome 12 |
| Location: | 3955894 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g516400 | SPL24 | Pre-mRNA splicing factor; (1 of 1) PF04146 - YT521-B-like domain (YTH) | 3'UTR|CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGCGGTAGTGCTGCCGGATGAAGTTCTC |
| Internal bar code: | TCATGCAAAGACATAACGCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1130 |
| LEAP-Seq percent confirming: | 99.1376 |
| LEAP-Seq n confirming: | 24142 |
| LEAP-Seq n nonconfirming: | 210 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCTTGCGTCTTGCTTTGT |
| Suggested primer 2: | GTCGTGAATGAAGCAAAGCA |