| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.090929 |
| Chromosome: | chromosome_11 |
| Location: | 1700278 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre11.g467781 | FAP151 | ABC transporter-like and Flagellar Associated Protein | antisense | intron |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | TGAACGCTTGCACGGTGGGCGCATACACGT |
| Internal bar code: | AGGTGTTCGTCGATGACTCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 658 |
| LEAP-Seq percent confirming: | 99.0139 |
| LEAP-Seq n confirming: | 3213 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTGAGGAGAGTGGTGAAA |
| Suggested primer 2: | GGGCCTAGGAGGAGAGAAGA |