| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.090997 |
| Chromosome: | chromosome 12 |
| Location: | 784401 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g495701 | (1 of 20) IPR001190//IPR017448 - SRCR domain // SRCR-like domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCTACCTCCCCACAGGCCCCATGTCGAG |
| Internal bar code: | CACTGTTACCTATTTGGAGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 126 |
| LEAP-Seq percent confirming: | 98.2857 |
| LEAP-Seq n confirming: | 516 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCAGCATGTGGACCTAGA |
| Suggested primer 2: | TGCGAGTTTGATATGGACGA |