Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.091057 |
Chromosome: | chromosome 1 |
Location: | 947493 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g005200 | TGL2 | (1 of 3) PTHR21493//PTHR21493:SF153 - CGI-141-RELATED/LIPASE CONTAINING PROTEIN // PROTEIN T08B1.4, ISOFORM B-RELATED; Putative triacylglycerol lipase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCCTGTCCTTGTGTGCTGTACGCACTGT |
Internal bar code: | CCCAATACGAATCCGGTACAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 718 |
LEAP-Seq percent confirming: | 99.4742 |
LEAP-Seq n confirming: | 2838 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCCTTTATCTTCGAGATGC |
Suggested primer 2: | GTAACGGCCCACACAGTCTT |