| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.091065 |
| Chromosome: | chromosome 12 |
| Location: | 7212195 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g558450 | SPD1 | Spermidine synthase; (1 of 1) K00797 - spermidine synthase (speE, SRM) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCACTGCCCGGTGCAGGGCCTCGAAGAA |
| Internal bar code: | GCTTGGTGCCTGCGCCGGGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 112 |
| LEAP-Seq percent confirming: | 81.0904 |
| LEAP-Seq n confirming: | 2350 |
| LEAP-Seq n nonconfirming: | 548 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | COULD_NOT_FIND_PRIMER |
| Suggested primer 2: | GTGCTGTTTGAGAAGGAGGG |