| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.091132 |
| Chromosome: | chromosome 9 |
| Location: | 7066937 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g411525 | (1 of 107) PF00069//PF07714 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCAGTAGCAGCGGCGGCAGGGTCAGCA |
| Internal bar code: | TGGCCCAGCGTAGTCCGCTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 283 |
| LEAP-Seq percent confirming: | 78.6796 |
| LEAP-Seq n confirming: | 1871 |
| LEAP-Seq n nonconfirming: | 507 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCAGTCAAAAACAGCAGC |
| Suggested primer 2: | GTACTCCCCAACAGCGTCAT |