Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.091138 |
Chromosome: | chromosome 7 |
Location: | 4123809 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g342850 | ODA5,DCC3 | (1 of 2) PTHR21694//PTHR21694:SF18 - UNCHARACTERIZED // COILED-COIL DOMAIN-CONTAINING PROTEIN 114; Outer Arm Dynein assembly protein 5 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTTGAGGGTGGTGTGGCACGCCGGCTCA |
Internal bar code: | CTCTTCTTCACAGCGGAGGGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 30 |
LEAP-Seq percent confirming: | 72.2222 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTTTCAAACGCCCAACACT |
Suggested primer 2: | CATTTGGGCACGTATAGGCT |