Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.091156 |
Chromosome: | chromosome 17 |
Location: | 6142364 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g741550 | (1 of 1) PTHR12072//PTHR12072:SF5 - CWF19, CELL CYCLE CONTROL PROTEIN // CWF19-LIKE PROTEIN 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCGGCGGGGTGGGTGGCTGGGTTGTTGC |
Internal bar code: | TATGGGCCATCATGCAGAGGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 394 |
LEAP-Seq percent confirming: | 85.2135 |
LEAP-Seq n confirming: | 11693 |
LEAP-Seq n nonconfirming: | 2029 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAACGGTATGTGAGTGGCCT |
Suggested primer 2: | ACCGTGAGGTGGAAACAAAG |