Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.091164 |
Chromosome: | chromosome 3 |
Location: | 1827131 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g154425 | CLASP,CLASP1 | (1 of 1) K16578 - CLIP-associating protein 1/2 (CLASP1_2); CLIP-associating-protein | CDS|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGGCGCTGCGGACACCGCACCTGCCGAA |
Internal bar code: | TTGGAACGCAAACGACAAAGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 42 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 136 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACAAGTCGGAGCTTGGAGA |
Suggested primer 2: | GTAAAAGCAGAGCGAGTGGG |