Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.091187 |
Chromosome: | chromosome 10 |
Location: | 2136697 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g433500 | PWR10 | (1 of 1) IPR003590//IPR006502 - Leucine-rich repeat, ribonuclease inhibitor subtype // Protein of unknown function PDDEXK-like; PWR motif protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCGGCCCGGGCCCTGATAGGTGCGGGCC |
Internal bar code: | CCGTGAAGCACTTGTGTACCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 200 |
LEAP-Seq percent confirming: | 85.0091 |
LEAP-Seq n confirming: | 930 |
LEAP-Seq n nonconfirming: | 164 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCTCGTAGCTCTGGATGGC |
Suggested primer 2: | ACGGCTACCACTACGTCCAC |