| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.091338 |
| Chromosome: | chromosome 16 |
| Location: | 3594204 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g682369 | CTP1 | (1 of 2) K17686 - Cu+-exporting ATPase (copA, ATP7); Copper transporting ATPase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAGGAAACGGGTGCTAGTTGGGGCGCGC |
| Internal bar code: | ACGGGTATGCGAGCGCTTAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 306 |
| LEAP-Seq percent confirming: | 80.9727 |
| LEAP-Seq n confirming: | 949 |
| LEAP-Seq n nonconfirming: | 223 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAACTACCTGTGGGCCAT |
| Suggested primer 2: | CTGCGAAGTAGTGCAGCTTG |