| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.091353 |
| Chromosome: | chromosome 4 |
| Location: | 2805870 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g224002 | (1 of 1) K10770 - alkylated DNA repair protein alkB homolog 8 [EC:1.14.11.- 2.1.1.229] (ALKBH8) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAGTGAGCTGGTGGCAAGAGATGGAGCA |
| Internal bar code: | GAACATTCAGTGTAGTCGGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 22 |
| LEAP-Seq percent confirming: | 98.2609 |
| LEAP-Seq n confirming: | 791 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGACTACATGGTGAGGGGAT |
| Suggested primer 2: | TCACCTGTGAAGGCTGAGTG |