| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.091359 |
| Chromosome: | chromosome 5 |
| Location: | 1661984 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g243000 | (1 of 1) K14491 - two-component response regulator ARR-B family (ARR-B) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCGGGTGCATCGCAGGGCTCCGGAGCT |
| Internal bar code: | TCCTGAAATGGGGTGGCACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 164 |
| LEAP-Seq percent confirming: | 95.7041 |
| LEAP-Seq n confirming: | 401 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGACTCATGCAACAACCCA |
| Suggested primer 2: | GCATGGCTGTGTCACCAC |