| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.091383 |
| Chromosome: | chromosome 9 |
| Location: | 6739953 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g409050 | OTU6 | (1 of 2) K13719 - ubiquitin thioesterase OTU1 (OTU1, YOD1); OTU-like cysteine protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCAAGGAGGGAGTGGAAAATTGAGCGAG |
| Internal bar code: | GTAATGCAAAAAGATCGATAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 447 |
| LEAP-Seq percent confirming: | 99.8506 |
| LEAP-Seq n confirming: | 1337 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGATGAGCAGCACACGGTC |
| Suggested primer 2: | GACAACAGCTGCCTGTTCAA |